Jon-D's blog

I've been enjoying a conversation with Martin Blum about Morpholinos, CRISPR mutants, funding and publication. He wrote:

Good morning Jon,

My study section at the German Research Council DFG now accepts MO-proposals, no problem. Still, many people particularly working in zebrafish are too careless with controls and rescues. That might backfire at one point in the future.

My take is that we will use CRISPR to validate MOs and then use MOs most of the time.

Best wishes,
Martin

-----------------------------------------------------
My response
-----------------------------------------------------

Hi Martin,

You want a CRISPR mutant to validate the Morphlino, but we know compensation in the mutant can conceal the effect of losing the protein, which can be revealed by a knockdown. What do you do if the Morpholino shows a phenotype and the CRISPR doesn't? Is this validation useful? More below...

I heartily agree that specificity controls need to be tight. Five-mispair oligos are worthless. Rescues are very good if they work, but ectopic expression can mess them up. The two-nonoverlapping-oligo phenocopy is good but there have been cases where both oligos have off-target interactions, so that can take more oligos to nail down. Checking for dose synergy with two non-overlapping oligos is stronger when combined with the one-oligo-at-a-time phenocopy previously mentioned. But my favorite specificity control today is:

You have a Morpholino and it produces a phenotype when injected into a wild-type creature. You also have the CRISPR mutant for the same target gene, it has no phenotype. You inject the Morpholino into the mutant, you see no phenotype. That tells us that compensation in the mutant is concealing the phenotype that the Morpholino reveals, and further tells us that the Morpholino phenotype is due to interaction with the targeted transcript and not an unexpected RNA. If that is the validation of a Morpholino with a CRISPR mutant that you are proposing, then I am enthusiastically on-board.

Alex reviewed this message prior to sending and pointed out that if the Morpholino has changed physical state, e.g. through aggregation in the solution state, then relying on a negative result (no Morpholino phenotype in the mutant) could be dangerous. To avoid that, the oligo should be injected to wild-type embryos and mutant embryos in the same session, so if there is an issue with the oligo's physical state then you won't see the Morpholino phenotype in the wild-type embryo.

There is a confounding problem that could show up for early phenotypes. If a heterozygous mother is bred to produce a homozygous mutant embryo, there could be some wild-type maternal transcript that a translation-blocking Morpholino could shut down. This might lead to a more extreme early phenotype in the Morpholino-injected embryos than in the homozygous mutants from heterozygous mothers, which have some wild-type maternal transcript. In this case, the Morpholino could be specific but the phenotype would persist in the mutant background.

I'll post this discussion in my blog; if you like I would be happy to credit you with stimulating this response (I won't do so unless you tell me to -- I could simply add to the blog your message in order to set up the response).

Best wishes to you too,

- Jon

-------------------------------------------------

Hi Jon,

Thank you so much for this reasoning on controls, and please: post it on you blog. I am aware of all you are saying, and we do struggle with specificity controls in some cases quite a bit. So far we have always managed to prove it and to convince referees of manuscripts.

With best wishes,
Martin

-------------------------------------------------

Note (Jon): I first became aware of a Morpholino-in-a-mutant strategy from Didier Stainier's group's paper on genetic compensation in morphants:
Rossi A, Kontarakis Z, Gerri C, Nolte H, Hölper S, Krüger M, Stainier DYR. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature. 2015;[Epub ahead of print] doi:10.1038/nature14580
http://www.nature.com/nature/journal/vaop/ncurrent/full/nature14580.html

This is about detecting the activity of a splice-modifying oligo by reverse-transcriptase PCR and gel electrophoresis.

The expected outcome of an exon targeting an exon 3 splice junction (either i2e3 or e3i3) is elimination of exon 3 from the mature mRNA (along with both of its flanking introns, i2 and i3). The typical way to assess activity of a splice-modifying oligo is to isolate RNA from treated samples and run reverse-transcriptase PCR (RT-PCR), then run the PCR product on a gel to assess the mass of the product against a DNA ladder.

I have some notes on the expected outcomes of splice-modifying oligos (and a description of some possible unexpected outcomes) elsewhere on my blog:

Splicing outcomes: targeting for exon skipping or intron inclusion

To detect elimination of exon 3, we would typically design primers to exons 2 and 4, set back from the e2i2 and i3e4 junctions sufficiently that the RT-PCR product without exon 3 will still be about 100 bases long (that way enough dye binds in the RT-PCR product to see it clearly on a gel; that's tough if the fragment is too short). For short exons, it might be necessary to place the primers more distantly, for instance in exons 2 and 5. If the product is subject to nonsense-mediated decay, you might not see the splice-modified band; instead, NMD is visualized as a dimming or disappearance of the band when compared to the wild-spliced (negative control) band. To compare band intensities, load the wells lightly so the bands are not saturated and compare with RT-PCR of a housekeeping gene to confirm your total RNA loading is comparable between wells. If the wells are overloaded (so the bands are saturated), you might not see a partial knockdown of the wild-spliced band.

FDA Grants Fast Track Designation to NS-065/NCNP-01 for the Treatment of Duchenne Muscular Dystrophy.

http://www.nippon-shinyaku.co.jp/english/company_profile/news.php?id=3113

Translational development of splice-modifying antisense oligomers.
Fletcher S, Bellgard MI, Price L, Akkari AP, Wilton SD.
Expert Opin Biol Ther. 2016 Nov 2:1-16. [Epub ahead of print]
http://www.tandfonline.com/doi/full/10.1080/14712598.2017.1250880

Housden BE, Muhar M, Gemberling M, Gersbach CA, Stainier DY, Seydoux G, Mohr SE, Zuber J, Perrimon N. Loss-of-function genetic tools for animal models: cross-species and cross-platform differences. Nat Rev Genet. 2016 Oct 31. doi: 10.1038/nrg.2016.118. [Epub ahead of print]

Our understanding of the genetic mechanisms that underlie biological processes has relied extensively on loss-of-function (LOF) analyses. LOF methods target DNA, RNA or protein to reduce or to ablate gene function. By analysing the phenotypes that are caused by these perturbations the wild-type function of genes can be elucidated. Although all LOF methods reduce gene activity, the choice of approach (for example, mutagenesis, CRISPR-based gene editing, RNA interference, morpholinos or pharmacological inhibition) can have a major effect on phenotypic outcomes. Interpretation of the LOF phenotype must take into account the biological process that is targeted by each method. The practicality and efficiency of LOF methods also vary considerably between model systems. We describe parameters for choosing the optimal combination of method and system, and for interpreting phenotypes within the constraints of each method.

http://www.nature.com/nrg/journal/vaop/ncurrent/full/nrg.2016.118.html

No Morpholino work in this one, but it explores a difference between targeting RNA versus DNA.

Cell-Intrinsic Adaptation Arising from Chronic Ablation of a Key Rho GTPase Regulator.
Cerikan B, Shaheen R, Colo GP, Gläßer C, Hata S, Knobeloch KP, Alkuraya FS, Fässler R, Schiebel E.
Dev Cell. 2016 Sep 28. pii: S1534-5807(16)30595-0. doi: 10.1016/j.devcel.2016.08.020.

http://www.sciencedirect.com/science/article/pii/S1534580716305950

"Thus, phenotypes of gene inactivation are critically dependent on the timescale, as acute knockdown reflects a transient state of adjustment to a new equilibrium that is attained following compensation."

The US Food and Drug Administration today (19 Sep 2016) granted Accelerated Approval to eteplirsen (EXONDYS 51), a Morpholino oligo-based treatment for some forms of Duchenne muscular dystrophy (DMD). This is the first approval of a Morpholino drug.

DMD, a devastating childhood disease that is usually fatal within the first 20 years of life, is caused when the protein dystrophin is not produced. Eteplirsen is a Morpholino antisense oligo targeting exon 51 of the DMD transcript to cause its excision from the DMD pre-mRNA. Some mutations causing DMD are frameshift mutation (often deletions) occurring adjacent to exon 51; for some of these, skipping exon 51 can restore the reading frame of the functional dystrophin protein and cause some internally-truncated dystrophin to be made.

http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm521263.htm
http://investorrelations.sarepta.com/phoenix.zhtml?c=64231&p=irol-newsAr...
http://www.bloomberg.com/news/articles/2016-09-19/sarepta-wins-approval-...

Eteplirsen (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488)

Morpholino phosphorodiamidate antisense oligomer

CTCCAACATCAAGGAAGATGGCATTTCTAG
20-mer
20% G
43% CG
Predicted Tm: 88.9°C at 10 µM oligo.

Oligo complement
CTAGAAATGCCATCTTCCTTGATGTTGGAG

DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation.
CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT
CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC
GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA
GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG

Once again, a conversation with a new Morpholino user led to a discussion others might find useful.

For the two non-overlapping oligo specificity control, you do two separate sets of injections of the two oligos targeting the same miRNA. If the embryos treated with the oligo targeting the 5' end of the miRNA produces the same phenotype as the oligo targeting the 3' end of the miRNA, then that is good: it supports the idea that the phenotype you are seeing is caused by knocking down the activity of the miRNA you intend to target, and not caused by binding to an unexpected RNA.

You might think that only the oligo that targets the guide strand of the miRNA would give a phenotype. The reason both of the oligos should work is that Morpholinos can invade the pre-miRNA and pri-miRNA before they have been processed into the mature double-stranded miRNA. Either one of the oligos can invade the immature miRNA hairpin and once the oligo is bound there is no longer a double-stranded RNA to be processed and become the mature miRNA. By opening up the hairpin and displacing part of the RNA, the Morpholino is acting as an inhibitor of miRNA processing enzymes (e.g. Drosha, Dicer). If both oligos can inhibit maturation of the miRNA, loss of the mature miRNA should produce the same phenotype in the embryos.

Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD, Plasterk RHA. Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. PLoS Biol. 2007;5(8): e203.
http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.005...

In response to a question about the history of Vivo-Morpholino use in rodent livers, I assembled this annotated citation list.

Wu N, Meng F, Invernizzi P, Bernuzzi F, Venter J, Standeford H, Onori P, Marzioni M, Alvaro D, Franchitto A, Gaudio E, Glaser S, Alpini G. The secretin/secretin receptor axis modulates liver fibrosis through changes in TGF-β1 biliary secretion. Hepatology. 2016 Apr 26. doi: 10.1002/hep.28622. [Epub ahead of print]
This paper used Vivo-Morpholinos in a liver-related study, but I am not certain the molecular target was in the liver ( I do not have access to the full article).

Ray D, Han Y, Franchitto A, DeMorrow S, Meng F, Venter J, McMillin M, Kennedy L, Francis H, Onori P, Mancinelli R, Gaudio E, Alpini G, Glaser SS. Gonadotropin-releasing hormone stimulates biliary proliferation by paracrine/autocrine mechanisms. Am J Pathol. 2015 Apr;185(4):1061-72. doi: 10.1016/j.ajpath.2014.12.004.

"In separate experiments, BDL rats (immediately after surgery)2 were treated with Vivo-Morpholino sequences against GnRH (5′-GATCGTTTCCATTCTGTTTGGATGT-3′, 1.0 mg/kg body weight/day to reduce the hepatic GnRH expression) or mismatch-morpholino sequences (5′-GAACCTTTCGATTCTCTTTCGATGT-3′) administered by an implanted portal vein catheter for 1 week."

Gallego-Villar L, Viecelli HM, Pérez B, Harding CO, Ugarte M, Thöny B, Desviat LR. A sensitive assay system to test antisense oligonucleotides for splice suppression therapy in the mouse liver. Mol Ther Nucleic Acids. 2014 Sep 16;3:e193. doi: 10.1038/mtna.2014.44.
"Mice were injected with different amounts of VMO from 6 to 50 mg/kg body weight, using i.p. or i.v. injections."

Francis H, McDaniel K, Han Y, Liu X, Kennedy L, Yang F, McCarra J, Zhou T, Glaser S, Venter J, Huang L, Levine P, Lai J-M, Liu C-G, Alpini G, Meng F. Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. J Biol Chem. 2014;[Epub ahead of print] doi:10.1074/jbc.M114.602383
"Furthermore, inhibition of miR-21 by specific Vivo-Morpholino and knockout of IL-6 in ethanol-treated mice also increased the expression of DR5 and FASLG in vivo during alcoholic liver injury."

Renzi A, Mancinelli R, Onori P, Franchitto A, Alpini G, Glaser S, Gaudio E. Inhibition of the liver expression of arylalkylamine N-acetyltransferase increases the expression of angiogenic factors in cholangiocytes. Hepatobiliary Surg Nutr. 2014;3(1):4-10. doi:10.3978/j.issn.2304-3881.2014.01.02
"We used normal and BDL rats that immediately after surgery were treated with Vivo-Morpholino sequences of AANAT or Morpholino mismatched (1 mg/kg BW/day) for one week via an implanted portal vein catheter as described by us (21). To minimize the amount of Vivo-Morpholino that circulates outside of the liver, we used a lower dose (1.0 mg/kg BW/day) (21) of Vivo-Morpholino than that used in a previous study (3.0 mg/kg/day)"

Glaser S, Meng F, Han Y, Onori P, Chow BK, Francis H, Venter J, McDaniel K, Marzioni M, Invernizzi P, Ueno Y, Lai JM, Huang L, Standeford H, Alvaro D, Gaudio E, Franchitto A, Alpini G. Secretin Stimulates Biliary Cell Proliferation by Regulating Expression of MicroRNA 125b and MicroRNA let7a in Mice. Gastroenterology. 2014 Feb 25. pii: S0016-5085(14)00241-8. doi: 10.1053/j.gastro.2014.02.030. [Epub ahead of print]
Two tail-vein injections at 30 mg/kg targeting microRNAs mmu-miR-125b or mmu-miR-let7

Lee TKW, Cheung VCH, Lu P, Lau EYT, Ma S, Tang KH, Tong M, Lo J, Ng IOL. Blockade of CD47 mediated CTSS-PAR2 signaling provides a therapeutic target for hepatocellular carcinoma. Hepatology. 2014;[Epub ahead of print] doi:10.1002/hep.27070
Human xenograft in mice, intratumoral injection

Ramachandran A, McGill MR, Xie Y, Ni HM, Ding WX, Jaeschke H. The receptor interacting protein kinase 3 is a critical early mediator of acetaminophen-induced hepatocyte necrosis in mice. Hepatology. 2013 Dec;58(6):2099-108. doi: 10.1002/hep.26547. Epub 2013 Oct 11.
"In vivo morpholinos were used as supplied by the manufacturer and injected ip in mice at a dose of 12.5 mg/kg body weight every 24h for 2 days."

Frampton G, Ueno Y, Quinn M, McMillin M, Pae HY, Galindo C, Leyva-Illades D, Demorrow S. The novel growth factor, progranulin, stimulates mouse cholangiocyte proliferation via Sirtuin1-mediated inactivation of FOXO1. Am J Physiol Gastrointest Liver Physiol. 2012 Oct 18. [Epub ahead of print]
"In parallel, mice were injected with 10 mg/kg/day (via tail vein) PGRN165 specific Vivo-morpholino or a mismatched control sequence 24 hr prior to BDL or sham surgery. Daily tail vein injections of Vivo-morpholino sequences were continued for two days post surgery."

Renzi A, Demorrow S, Onori P, Carpino G, Mancinelli R, Meng F, Venter J, White M, Franchitto A, Francis H, Han Y, Ueno Y, Dusio G, Jensen KJ, Greene JJ, Glaser S, Gaudio E, Alpini G. Modulation of the biliary expression of arylalkylamine N-acetyltransferase alters the autocrine proliferative responses of cholangiocytes. Hepatology. 2012 Oct 18. doi: 10.1002/hep.26105. [Epub ahead of print]
"In separate experiments, healthy or BDL (immediately after surgery)2 rats (n = 9 per group) were treated with Vivo-Morpholino sequences of AANAT (5′-GTTCCCCAGCTTTGGAAGTGGTCCC, to reduce hepatic expression of AANAT) or mismatched Morpholino (5′-GTTCCCGACCTTTGCAACTCGTCCC) (Gene Tools LCC, Philomath, OR) for 1 week by an implanted portal vein catheter (Supporting Materials). Serum, liver tissue, cholangiocytes, pineal gland, kidney, spleen, small intestine, stomach, and heart were collected. Because we aimed to selectively knock down AANAT expression in the liver, we used a lower dose (1.0 mg/kg BW/day) of Vivo-Morpholino than that previously described (3.0 mg/kg/day).17 This approach minimizes the amount of Vivo-Morpholino that circulates outside of the liver after slow infusion into the portal vein."

Here's a report of a phase 1 clinical trial with a Morpholino oligo.

Komaki H, Nagata T, Saito T, Masuda S, Takeshita E, Tachimori H, Sasaki M, Takeda S. Exon 53 skipping of the dystrophin gene in patients with Duchenne muscular dystrophy by systemic administration of NS-065/NCNP-01: A phase 1, dose escalation, first-in-human study. Neuromuscular Disord. 2015;26(2)S261-2. doi:10.1016/j.nmd.2015.06.276

Antisense oligonucleotide-induced exon skipping, which is being studied for the treatment of Duchenne muscular dystrophy (DMD), allows synthesis of partially functional dystrophin. Patients amenable to exon 53 skipping form the second-largest population after patients amenable to exon 51 skipping. Therefore, in 2009, the National Center of Neurology and Psychiatry and Nippon Shinyaku Company collaborated to jointly develop an exon 53-skipping drug; an investigator-initiated clinical trial was started in June 2013 (NCT02081625) to examine the efficacy of NS-065/NCNP-01, a morpholino-based antisense oligonucleotide that facilitates skipping of exon 53 of the dystrophin gene.

http://www.nmd-journal.com/article/S0960-8966(15)00457-5/abstract