Jon-D's blog

Here's an example of using Morpholinos to validate target specificity of antibodies.

Belgacem YH, Borodinsky LN. Inversion of Sonic hedgehog action on its canonical pathway by electrical activity. Proc Natl Acad Sci U S A. 2015 Mar 31;112(13):4140-5. doi: 10.1073/pnas.1419690112. Epub 2015 Mar 17.

http://www.pnas.org/content/112/13/4140.long

"To prove specificity of anti-Gli2 and anti-Gli3 antibodies used in this study, X. laevis Gli2- and Gli3-targeted translation-blocking morpholinos (Gli2-MO: GCACAGAACGCAGGTAATGCTCCAT; Gli3-MO: GACTGGGCTTCCATGTTGTCTTCTC) were unilaterally (Gli2-MO) or bilaterally (Gli3-MO) injected at the two-cell-stage. Embryos were processed for Western blot or immunohistochemistry assays and probed with indicated antibodies."

I've been watching several websites with discussions of morphant and mutant comparisons. Here are links to the sites. The comments sections have been very supportive of Morpholino technology. I'll update this page as I find more.

The Node
Out with the old, in with the new: reassessing morpholino knockdowns in light of genome editing technology
August 6th, 2014
Stefan Schulte-Merker and Didier Y. R. Stainier
http://thenode.biologists.com/out-with-the-old-in-with-the-new-reassessi...

PubPeer
"Conserved function of lincRNAs in vertebrate embryonic development despite rapid sequence evolution"
Feb 23rd, 2015
https://pubpeer.com/publications/AA3A9AB44B044BC25BA5252EAC6023#fb26053

Biotechniques
Mutants vs. Morphants
May 2nd, 2015
Rachael Moeller Gorman
http://www.biotechniques.com/news/Mutants-vs.-Morphants/biotechniques-35...

Retraction Watch
PubPeer Selections: Odd citations, “practice makes perfect,” a Nature update
Feb 27rd, 2015
http://retractionwatch.com/2015/02/27/pubpeer-selections-odd-citations-p...

Faculty of 1000
Discussion of: "Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish."
http://f1000.com/prime/725287967
Requires subscription

Discussion of:"Genetic compensation induced by deleterious mutations but not gene knockdowns."
http://f1000.com/prime/725631655

Nature
Rossi A, Kontarakis Z, Gerri C, Nolte H, Hölper S, Krüger M, Stainier DYR. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature. 2015;[Epub ahead of print] doi:10.1038/nature14580
http://www.nature.com/nature/journal/vaop/ncurrent/full/nature14580.html

ScienceNews
Hesman Saey T. Mutation-disease link masked in zebrafish. ScienceNews. 2015;July 13
https://www.sciencenews.org/article/mutation-disease-link-masked-zebrafish

On Biology (BioMed Central)
Graham Bell. Reproducibility and morpholinos: different methods, different answers. 2015;July 23
http://blogs.biomedcentral.com/on-biology/2015/07/23/reproducibility-mor...

Zebrafish
Gene Tools publishes a response to Kok et al. 2014.
Morcos PA, Vincent AC, Moulton JD. Gene Editing Versus Morphants. Zebrafish. 2015 Oct;12(5):319. doi: 10.1089/zeb.2015.1114.
http://online.liebertpub.com/doi/pdfplus/10.1089/zeb.2015.1114
Points out excessive 20ng/embryo dosing in zebrafish used as evidence of Morpholino off-target effects

Developmental Cell
Blum M, De Robertis EM, Wallingford JB, Niehrs C. Morpholinos: Antisense and Sensibility. Dev Cell. 2015;35(2):145-9. doi:10.1016/j.devcel.2015.09.017
http://www.sciencedirect.com/science/article/pii/S1534580715006188
"Here, we argue that Kok et al. should not be taken as an argument to ban the first-time use of MOs. Instead, adequately controlled MOs should continue to be accepted as generic loss-of-function approach in the absence of genetic evidence, if progress in developmental biology is not to suffer."

BioMed Central Blog network, Graham Bell, 23 July 2015. Reproducibility and morpholinos: different methods, different answers.
https://blogs.biomedcentral.com/on-biology/2015/07/23/reproducibility-mo...
"Finally, returning to the theme of reproducibility in research, both methods might be reliable (repeatable) in the results observed in this case; the trick is to try to be sure about what question you want to ask, and what question a particular method is actually going to help answer."

Proc Natl Acad Sci U S A
Won M, Ro H, Dawid IB. Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas. Proc Natl Acad Sci U S A. 2015 Sep 21. pii: 201517033. [Epub ahead of print]
"Recent publications and much informal discussions have raised doubts about the validity of morphant phenotypes. Although this suspicion is undoubtedly well founded in certain instances, we show here that failure of a null mutant to replicate a morphant phenotype may have complex and ultimately insightful reasons. It should be noted that Kok et al. considered the possibility of functional redundancy of paralogs and possible effects of exon skipping in the interpretations. Our example emphasizes the need to consider these and possibly other effects in evaluating mutant versus morphant phenotypes."

PLoS One
Novodvorsky P, Watson O, Gray C, Wilkinson RN, Reeve S, Smythe C, Beniston R, Plant K, Maguire R, M K Rothman A, Elworthy S, van Eeden FJ, Chico TJ. klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes. PLoS One. 2015 Oct 27;10(10):e0141611. doi: 10.1371/journal.pone.0141611. eCollection 2015.
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0141611
"In summary, our work shows that even in the face of clear evidence of a potentially disruptive mutation induced in a gene of interest, it is currently very difficult to be certain that this leads to loss-of-function, and hence to be confident about the role of the gene in embryonic development."

Trends in Cell Biology
Nathan D. Lawson
Reverse Genetics in Zebrafish: Mutants, Morphants, and Moving Forward
December 2015
http://www.sciencedirect.com/science/article/pii/S0962892415002366
"Gene editing in zebrafish has begun to reveal discordance between mutant phenotypes and those associated with knockdown via morpholino oligonucleotides (MOs). These studies suggest that MOs should not be used as a standalone tool and underscore the need for guidelines that require defined mutants to assess gene function in zebrafish."

PLoS Genet. 2016;12(2):e1005881. doi:10.1371/journal.pgen.1005881
Hu M, Bai Y, Zhang C, Liu F, Cui Z, Chen J, Peng J.
Liver-Enriched Gene 1, a Glycosylated Secretory Protein, Binds to FGFR and Mediates an Anti-stress Pathway to Protect Liver Development in Zebrafish.
http://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.10...
In replicating Morpohlino results with TALEN-induced mutations, the authors found that the phenotype was more severe with the Morpholino. They sought the reason for the discrepancy and found that compared to wild-type fish, the expression of leg1b was eleveated in leg1a mutants. "These data suggest that the expression of leg1b is mobilized to compensate, at least partially, for the loss of function of Leg1a in the leg1a(zju1) mutant."

EMBO reports (2016) embr.201541532 doi:10.15252/embr.201541532
Zhao Z, Lee RTH, Pusapati GV, Iyu A, Rohatgi R, Ingham PW.
An essential role for Grk2 in Hedgehog signalling downstream of Smoothened.
http://embor.embopress.org/content/early/2016/04/04/embr.201541532
"Our findings indicate a more critical requirement for Grk2 activity than has hitherto been appreciated. The mild morphant phenotype in zebrafish embryos together with the moderate reduction in Shh responsiveness of cells elicited by Grk2 siRNA led to the conclusion that GRK2 acts only to potentiate the response of cells to Hh. However, our analysis of both grk2 embryos and mutant cells reveals that the response to Hh is effectively abolished in the absence of Grk2. Notably, neither zygotic grk2 nor MZgrk2 zebrafish embryos show the developmental retardation reported to occur in Grk2 morphants, suggesting this to be an off‐target effect of the morpholino. This underlines the need for caution in interpreting effects associated with morpholino antisense oligonucleotide injection and the importance of analysing stable transmissible null mutations when characterising gene function. "

Mol Cell Biol. 2016 Sep 6. pii: MCB.00281-16. [Epub ahead of print]
Moore JC, Mulligan TS, Torres Yordán N, Castranova D, Pham VN, Tang Q, Lobbardi R, Anselmo A, Liwski RS, Berman JN, Sadreyev RI, Weinstein BM, Langenau DM.
T cell immune deficiency in zap70 mutant zebrafish.
http://mcb.asm.org/content/early/2016/08/30/MCB.00281-16.abstract
"Here, we describe a zap70 loss-of-function mutation in zebrafish (zap70y442) that was created using TALENs. In contrast to what has been reported in morphant zebrafish, zap70y442 homozygous mutant zebrafish displayed normal development of blood and lymphatic vasculature. Hematopoietic cell development was also largely unaffected in mutant larvae. However, mutant fish had reduced lck:GFP+ thymic T cells by 5 days post-fertilization that persisted into adult stages."

Essay (2016) by Dani Wijesinghe: "Knockdowns versus knockouts: why the phenotypic difference?"
https://medium.com/@daniwijesinghe/knockdowns-versus-knockouts-why-the-p...
(added Dec 2018)

I was concerned when Stefan Schulte-Merker and Didier Stainier' paper appeared in mid-2014, first in Development and then on The Node. Later in 2014 Nathan Lawson's paper in Developmental Cell was published. Prior to these papers I was intrigued and excited by CRISPR technology but felt that, while it might temporarily displace some use of Morpholinos, in the long run it would benefit Morpholino use by making the zebrafish model stronger. However, the tone of these publications concerned me as the authors suggested that no Morpholino data is strong unless it agrees with CRISPR data (that is, unless the Morpholinos have been validated by phenocopying CRISPR knockouts).

I attended the Strategic Conference of Zebrafish Investigators meeting in January of 2015 at Asilomar in Pacific Grove, California. In the first morning sessions Dr. Nathan Lawson presented his data, followed by Dr. Didier Stainier. Dr. Lawson asserted that CRISPR knockouts were the gold standard to which all other expression-altering technologies should be compared. He tried to persuade the audience that if a Morpholino failed to phenocopy a CRISPR knockout then the data from the Morpholino were wrong, and that only "validated" (CRISPR-phenocopying) Morpholinos should be used.

Dr. Lawson's presentation was followed by Dr. Stainier. Dr. Stainier presented array studies of CRISPR mutants which did not recapitulate the knockdown phenotypes of morphants. He showed that there were widespread changes in gene expression in the mutants relative to wild-type and suggested that the failure to phenocopy was due to compensation by the mutants; He suggested that in seeking homeostasis the mutants were obscuring the knockdown phenotype by altering expression of other genes. He suggested that while Morpholinos may sometimes present false positives, CRISPRs tend to present false negatives.

After Dr. Stainier's presentation the community had a one-hour discussion titled "Mutants vs. Morphants". In general the community was very supportive of the existing Morpholino-based body of data and did not agree that future work with Morpholinos should only be accepted if the knockdowns are validated against CRISPR mutants. They pointed out that the problems with Morpholinos are well known and that with good experimental design and strong controls you can be confident of your results. They admonished Dr. Lawson's use of words like "rigor" and "gold standard" applied to CRISPRs, asserting that these terms were inflammatory and prejudicial and could inappropriately influence reviewers and study section leaders, especially those without strong bench experience with knockdowns and mutants. The last community member to speak said that it makes no sense to refer to "mutants" as if they are simply knockouts, that instead there is a range of alleles with different characteristics for every gene locus and that the CRISPR mutants would be expected to have a range of expression as do natural alleles. The community agreed that a paper should be produced stating that Morpholinos can stand on their own as a tool to interrogate gene function and delineating some community standards for use and comparison of mutants and morphants.

The strong support of the zebrafish community has eased my concerns over the future acceptance of Morpholino data for grants and publications. With strong specificity controls (particularly the two-nonoverlapping-oligo approach) to eliminate false positives, the data produced by Morpholinos are not only as reliable as CRISPRs but can reveal functions of genes which a corresponding CRISPR mutant might obscure by compensation. Morpholinos are a fast method and, when lab worker costs are included, are as inexpensive as the mutation methods. There are many functions you can perform with a Morpholino which a CRISPR mutation cannot do: splice redirection, blocking poly-A signal sites, protecting miRNA target sites, blocking zipcode binding sequences, and the other molecular "masking tape" approaches available at the RNA level. I expect that the CRISPR-Morpholino controversy will still take some time to play out, but the reviewers and study section leaders will soon understand that Morpholinos are still the best available technology for RNA-level manipulations and are not expected to phenocopy all outcomes of DNA manipulations.

Schulte-Merker S, Stainier DY. Out with the old, in with the new: reassessing morpholino knockdowns in light of genome editing technology. Development. 2014 Aug;141(16):3103-4. doi: 10.1242/dev.112003.

Schulte-Merker and Stanier on The Node: http://thenode.biologists.com/out-with-the-old-in-with-the-new-reassessi...

Kok FO, Shin M, Ni C-W, Gupta A, Grosse AS, van Impel A, Kirchmaier BC, Peterson-Maduro J, Kourkoulis G, Male I, DeSantis DF, Sheppard-Tindell S, Ebarasi L, Betsholtz C, Schulte-Merker S, Wolfe SA, Lawson ND. Reverse Genetic Screening Reveals Poor Correlation between Morpholino-Induced and Mutant Phenotypes in Zebrafish. Dev Cell. 2014;[Epub ahead of print] doi:10.1016/j.devcel.2014.11.018.

Here are some notes discussing how Morpholino oligos can change activity over time, along with strategies for recovering and maintaining activity.

Change over time in Morpholino activity

The most likely reason for variability in oligo activity over time is a change in the physical state of the Morpholino oligos, in particular association of the oligos with each other to form complexes. Morpholinos can complex by several mechanisms: they can form complexes dissolved or dispersed in solution or they can associate with container walls. Chilling or freeze-thaw cycling inceases the likelihood of complexation.

You can detect the container association by UV spec, because the UV activity in the bulk solution decreases. However, a UV measurement won't detect the dispersed complexes. UV spec of Morpholinos is generally done in acidic solution (0.1M HCl) to suppress the hypochromic effect of base-stacked oligos. As some bases protonate at low pH they unstack. Making some bases cationic to unstack the oligos will also dissociate complexes, so even if dispersed complexes are formed you can still detect the oligos by UV. This is a problem because if you have dissolved or dispersed complexes, you can't tell with a UV measurement.

Complexes

Many sequences do not complex. Some do complex over time and different sequences complex at different rates, affected by storage conditions. In addition to variability, complexation is sometimes associated with increased toxicity. We've measured complexation using HPLC on size-exclusion columns, testing a group of sequences over months of storage frozen, in the refrigerator, and at room temperature. Some sequences stayed in solution. The complexing sequences could be partially broken up by heating at 65C but, for the difficult complex-forming sequences which we tested, most of the oligo did not dissociate with that treatment although the complexes did release some single-stranded oligo. More heat is more effective for dissociating the complexes. Autoclaving is an option, and customers have reported some success at recovering full activity of some sequences which had lost most activity; when the efficacy of autoclaving was tested using the HPLC size-exclusion system, autoclaving dissociated most of the difficult complexes into single-stranded oligo (HM Moulton, pers. comm.). We know that Morpholinos can take several rounds of autoclaving without significant degradation so I am comfortable suggesting that you try that technique if you find a stock's biological activity is decreasing (though I'd avoid running one batch of oligo though the autoclave too many times; five or so is probably fine). To be sure that your container & autoclave system maintains the volume of fluid in the container, it is prudent to put some colored water into the same type of container your Morpholino is contained within and autoclave the tube of colored water prior to autoclaving the Morpholino solution. Remove the container right after the pressure returns to atmospheric. There shouldn't be evaporation when the oligo solution is under steam (that's already water-saturated), but you could lose volume in a hot vial at atmospheric pressure once the water content of the air over the vial returns to ambient conditions. That's why it's best to pull the vial out right after the sterilization run -- the vial can cool more quickly to room temperature.

If there are complexed oligos in your stock solution, especially if relatively large complexes have formed, the stock is inhomogeneous and different same-volume aliquots for microinjections can contain different amounts of oligo. If the original stock is inhomogeneous, aliquoting for storage can cause problems because you end up with aliquots containing different concentrations of Morpholino. Heating and vortexing prior to aliquoting can help and will be enough for some, but not all, sequences. Autoclaving is the technique most likely to completely dissolve the oligos.

Container association

We originally recommended storing oligos cold, but we found that oligos often lost activity by associating with container walls. This was observed as a decrease in oligo activity along with a decrease in stock UV activity over time, and the UV activity could be recovered in the dry vial with 0.1N HCl. Some sequences are difficult or impossible to get redissolved off the container without acidifying the solution to very low pH (around pH 1). When we changed our recommendation to room-temperature storage, Morpholino users no longer reported the decrease in UV activity over time but continued to report the decrease in biological activity for some sequences. In early 2013, we learned from the HPLC size-exclusion experiments that complexes were forming over months in solution, that storage at room temperature favors complex formation more than storage at reduced temperatures, and that the complexes could be dissociated by autoclaving. Low temperature favors container association, room temperature favors complexation; because the activity of container-associated oligos is sometimes impossible to recover and the activity of complexes can be recovered by autoclaving, we have maintained our recommendation to store Morpholino solutions at room temperature.

Avoiding dried-out stocks

When oligo solutions are stored at room temperature there is a risk of the stocks drying out. Very tightly sealed containers can help prevent or at least delay the loss of water vapor, but the most secure storage method is to keep tightly-sealed oligo containers in a humidor. Placing a small open beaker of water along with the oligo containers into a bell jar or a sealed desiccator (without a desiccant) is a good method for long-term storage in solution, as the vapor pressure of water in the sealed container will be at saturation and so there is no driving force for drying out the oligo stocks.

Best long-term storage

The most stable way to store oligos is to lyophilize them. This presents tremendous surface area in the solid lyophilized material, aiding dissolution. We've heard reports from a few labs that use many oligo sequences and routinely aggressively dissolve new oligos, aliquoting and lyophilizing the aliquots. They say that this has improved the reproducibility of experiments. Here is a discussion of storage and lyophilization -- http://www.gene-tools.com/files/Storage_RTorLyophilized_v3.pdf

Chemical stability

Morpholino oligos are very chemically stable; there have been studies of enzymatic resistance of Morpholinos and no enzyme system was found to degrade them (Hudziak 1996, Youngblood 2007). We've run oligos through MALDI-TOF over the years after they have been returned from labs due to activity decreasing. We only detect full-length oligo in these samples. However, the change in physical state of some sequences can affect their activity.

Concluding remarks

Careful attention to the physical state of the oligos will help you to achieve more consistent results. The routine heating to 65C helps, but alone it is probably not enough for some sequences; autoclaving before a group of experiments is OK. Because storing oligos cold can favor association with container surfaces, from which is especially difficult to recover oligo activity, we suggest room-temperature storage (ideally in a humidor). Pay particular attention to the physical state of the oligos if aliquoting, as this can affect reproducibility between aliquots. Finally, consider lyophilizing as a long-term storage strategy for aliquots; we've dissolved lyophilized aliquots that have been stored dry for over a decade and they work fine.

We make custom chemicals. This means every new sequence has new physical properties. We're learning more about how to handle the oligos and I'm happy to tell you what we've learned in general, but each new oligo is a new compound and we expect variation between the behaviors of different sequences. As you learn more about keeping your oligos into solution, please let me know what techniques have worked for you; that will improve what I can do for the next investigator.

References

Hudziak RM, Barofsky E, Barofsky DF, Weller DL, Huang SB, Weller DD. Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation. Antisense Nucleic Acid Drug Dev 1996 Winter;6(4):267-72

Youngblood DS, Hatlevig SA, Hassinger JN, Iversen PL, Moulton HM. Stability of cell-penetrating peptide-morpholino oligomer conjugates in human serum and in cells. Bioconjug Chem. 2007 Jan-Feb;18(1):50-60.

Faulkner RL, Wishard TJ, Thompson CK, Liu H-H, Cline HT. FMRP regulates neurogenesis in vivo in Xenopus laevis tadpoles. eNeuro. 2014;[Epub ahead of print] doi:10.1523/ENEURO.0055-14.2014

http://eneuro.org/content/eneuro/early/2014/12/31/ENEURO.0055-14.2014.fu...

"Plasmids and morpholinos were injected into the brain ventricle, then platinum electrodes were placed on each side of the midbrain and voltage pulses were applied across the midbrain to electroporate optic tectal cells in stage 46 tadpoles."

An injection volume of 500 pL is reasonable (Rosen et al. 2009, http://www.jove.com/video/1115/microinjection-of-zebrafish-embryos-to-an...). The basic rule for dosing of Morpholino injections is to use the least dose that gives you the phenotype of interest. As the dose increases, so does the potential for off-target RNA interactions and, with that, the potential of seeing a phenotype that has nothing to do with your target RNA. The higher the dose of oligo, the more mispairs will be tolerated in RNA binding. The probability of an off-target interaction increases with increasing oligo CG content and less strongly with increasing oligo length, affecting the "safe" dose, but we have no calculation to address this. Exceeding about 5 ng per embryo increases the risk of seeing a phenotype caused by an off-target interaction; using lower doses, you can have more confidence that the phenotype is due to interaction with the target RNA though specificity controls should still be performed, while at higher doses you need to be be increasingly rigorous about your specificity controls (I'd prefer to see doses stated by mole, but there is a strong tradition of writing doses by mass). However, you shouldn't trust that controlling dosing will eliminate off-target effects; there are two other steps that increase confidence that the observed phenotype is due to interaction with the target RNA and not an unexpected RNA. First, coinject a p53 oligo to prevent phenotypic changes triggered by loss of the protein of interest and caused by p53-mediated apoptosis (See Robu et al. 2007, http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1877875/). Second, use a nonoverlapping Morpholino targeting the same RNA as a specificity control. If the two oligos produce the same phenotype when separately injected, this supports the hypothesis that the phenotype is due to knockdown of the targeted RNA and not an interaction with an unexpected RNA. If the oligos elicit the phenotype with dose synergy when coinjected, this further supports specificity of the phenotype (Bill et al. 2009, http://online.liebertpub.com/doi/pdfplus/10.1089/zeb.2008.0555).

I'd appreciate any feedback on this discussion. Thanks!

Progatzky F, Sangha NJ, Yoshida N, McBrien M, Cheung J, Shia A, Scott J, Marchesi JR, Lamb JR, Bugeon L, Dallman MJ. Dietary cholesterol directly induces acute inflammasome-dependent intestinal inflammation. Nat Commun. 2014 Dec 23;5:5864. doi: 10.1038/ncomms6864.

http://www.nature.com/ncomms/2014/141223/ncomms6864/full/ncomms6864.html

This paper claims delivery of Morpholino to the intestinal epithelium of zebrafish by putting Morpholinos in the fish water around feeding time.

"As the knockdown efficiency of MO injected into single-cell stage embryos diminishes after 5 days post fertilization (dpf) ... we devised a novel delivery method by simply adding the MO to the fish water 24-h before and during the 6-h feeding period."

"First, we validated this new method by imaging MO uptake in the intestine ..."

"Second, analysis by flow cytometry following treatment with the FITC-conjugated ​ASC splice-blocking MO revealed an increase in FITC fluorescence in Cytokeratin+ epithelial cells but not in mCherry+ macrophages in Tg(​fms:mCherry), or in dsRed+ neutrophils in Tg(​lyz:dsRed) larvae ..."

"Finally, we confirmed the ability of this MO to significantly knock down ​ASC mRNA by performing reverse-transcription PCR (RT-PCR) on injected embryos (Supplementary Fig. 10) and quantitative RT-PCR (qRT-PCR) on sorted FITC+ cells"

"...we used a GFP MO (not tagged with FITC) to target GFP in Tg(ubi:EGFP) fish35 and found significantly decreased fluorescence intensity in intestinal cells (Supplementary Fig. 11)."

Protocol, figure 1 legend:
"Fig. 1. Schematic representation of the protocol used for experiments. Zebrafish larvae at 6 days post-fertilisation (dpf) were pre-treated with indicated drugs for 30 minutes (min) followed by feeding with ZM control diet or high cholesterol diet (HCD) for 6 hours (h) in the presence of drugs (top panel). Zebrafish larvae (6 dpf) were pre-treated with indicated morpholino oligonucleotides for 24 hours and followed by feeding with ZM control diet or HCD for 6 hours in the presence of morpholinos (bottom panel). The quantification of total cell numbers of indicated immune cells in the intestine were performed at 18 hours post feeding."

Here is an interesting strategy for nailing down the relationship between a phenotype and a particular mutation. Using a zebrafish pnpla6 morphant, co-injection of wild-type human pnpla6 mRNA rescued the morphant phenotype while mutant human pnpla6 mRNA failed to rescue.

Hufnagel RB, Arno G, Hein ND, Hersheson J, Prasad M, Anderson Y, Krueger LA, Gregory LC, Stoetzel C, Jaworek TJ, Hull S, Li A, Plagnol V, Willen CM, Morgan TM, Prows CA, Hegde RS, Riazuddin S, Grabowski GA, Richardson RJ, Dieterich K, Huang T, Revesz T, Martinez-Barbera JP, Sisk RA, Jefferies C, Houlden H, Dattani MT, Fink JK, Dollfus H, Moore AT, Ahmed ZM. Neuropathy target esterase impairments cause Oliver-McFarlane and Laurence-Moon syndromes. J Med Genet. 2014 Dec 5. pii: jmedgenet-2014-102856. doi: 10.1136/jmedgenet-2014-102856. [Epub ahead of print]

http://jmg.bmj.com/content/early/2014/12/05/jmedgenet-2014-102856.abstract

These are some papers using Morpholinos in mouse, published in 2014.

Vivo-Morpholino

WT1 controls antagonistic FGF and BMP-pSMAD pathways in early renal progenitors . Motamedi FJ, Badro DA, Clarkson M, Rita Lecca M, Bradford ST, Buske FA, Saar K, Hübner N, Brändli AW, Schedl A. Nat Commun. 2014 Jul 17;5:4444. doi: 10.1038/ncomms5444.
Vivo-Morpholino in kidney organ culture.

Effect of Combined Systemic and Local Morpholino Treatment on the Spinal Muscular Atrophy Δ7 Mouse Model Phenotype. Nizzardo N, Simone C, Salani S, Ruepp M-D, Rizzo F, Ruggieri M, Zanetta C, Brajkovic S, Moulton HM, Müehlemann O, Bresolin N, Comi GP, Corti S. Clin Therap. 2014. 36(3):340-56. doi:10.1016/j.clinthera.2014.02.004.
Vivo-Morpholino in SMA model.

miR-142-3p balances proliferation and differentiation of mesenchymal cells during lung development. Carraro G, Shrestha A, Rostkovius J, Contreras A, Chao CM, El Agha E, Mackenzie B, Dilai S, Guidolin D, Taketo MM, Günther A, Kumar ME, Seeger W, De Langhe S, Barreto G, Bellusci S. Development. 2014 Feb 19. [Epub ahead of print].
Vivo-Morpholino in lung explant culture.

Secretin Stimulates Biliary Cell Proliferation by Regulating Expression of MicroRNA 125b and MicroRNA let7a in Mice. Glaser S, Meng F, Han Y, Onori P, Chow BK, Francis H, Venter J, McDaniel K, Marzioni M, Invernizzi P, Ueno Y, Lai JM, Huang L, Standeford H, Alvaro D, Gaudio E, Franchitto A, Alpini G. Gastroenterology. 2014 Feb 25. pii: S0016-5085(14)00241-8. doi: 10.1053/j.gastro.2014.02.030. [Epub ahead of print].
Vivo-Morpholino.

Differential Skeletal Muscle Proteome of High and Low Active Mice. Ferguson DP, Dangott LJ, Schmitt EE, Vellers HL, Lightfoot JT. Differential J Appl Physiol. 2014 Feb 6. [Epub ahead of print].
Vivo-Morpholino.

A sensitive assay system to test antisense oligonucleotides for splice suppression therapy in the mouse liver. Gallego-Villar L, Viecelli HM, Pérez B, Harding CO, Ugarte M, Thöny B, Desviat LR. Mol Ther Nucleic Acids. 2014 Sep 16;3:e193. doi: 10.1038/mtna.2014.44.
Vivo-Morpholino.

Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. Francis H, McDaniel K, Han Y, Liu X, Kennedy L, Yang F, McCarra J, Zhou T, Glaser S, Venter J, Huang L, Levine P, Lai J-M, Liu C-G, Alpini G, Meng F. J Biol Chem. 2014;[Epub ahead of print] doi:10.1074/jbc.M114.602383.
Vivo-Morpholino.

Antisense-mediated Exon Skipping Decreases Tau Protein Expression: A Potential Therapy For Tauopathies. Sud R, Geller ET, Schellenberg GD. Mol Ther Nucleic Acids. 2014 Jul 29;3:e180. doi: 10.1038/mtna.2014.30.
Vivo-Morpholino.

Gli1 Activation and Protection Against Hepatic Encephalopathy is Suppressed by Circulating Transforming Growth Factor β1 in Mice. McMillin M, Galindo C, Pae HY, Frampton G, Di Patre PL, Quinn M, Whittington E, DeMorrow S. J Hepatol. 2014;[Epub ahead of print] doi:10.1016/j.jhep.2014.07.015.
Vivo-Morpholino.

Genetic Targets of Hydrogen Sulfide in Ventilator-Induced Lung Injury - A Microarray Study. Spassov S, Pfeifer D, Strosing K, Ryter S, Hummel M, Faller S, Hoetzel A. PLoS One. 2014 Jul 15;9(7):e102401. doi: 10.1371/journal.pone.0102401. eCollection 2014.
Vivo-Morpholino.

TLR7 is a key regulator of innate immunity against Japanese Encephalitis Virus infection. Nazmi A, Mukherjee S, Kundu K, Dutta K, Mahadevan A, Shankar SK, Basu A. Neurobiol Dis. 2014 Jun 5. pii: S0969-9961(14)00154-5. doi: 10.1016/j.nbd.2014.05.036. [Epub ahead of print].
Vivo-Morpholino.

Lessons learned from vivo-morpholinos: How to avoid vivo-morpholino toxicity. Ferguson DP, Dangott JJ, Timothy Lightfoot JT. BioTechniques. 2014;56(5):251-6.
Vivo-Morpholino.

Dynamic Expression of Chymotrypsin-Like Elastase 1 Over the Course of Murine Lung Development. Liu S, Young SM, Varisco BM. Am J Physiol Lung Cell Mol Physiol. 2014 May 2. [Epub ahead of print].
Vivo-Morpholino.

De novo mutation in ATP6V1B2 impairs lysosome acidification and causes dominant deafness-onychodystrophy syndrome. Yuan Y, Zhang J, Chang Q, Zeng J, Xin F, Wang J, Zhu Q, Wu J, Lu J, Guo W, Yan X, Jiang H, Zhou B, Li Q, Gao X, Yuan H, Yang S, Han D, Mao Z, Chen P, Lin X, Dai P. Cell Res. 2014 Jun 10. doi: 10.1038/cr.2014.77. [Epub ahead of print].
Intracochlear injection of Vivo-Morpholino.

Peptide-linked Morpholino

Antisense Oligonucleotide-mediated Suppression of Muscle Glycogen Synthase 1 Synthesis as an Approach for Substrate Reduction Therapy of Pompe Disease. Clayton NP, Nelson CA, Weeden T, Taylor KM, Moreland RJ, Scheule RK, Phillips L, Leger AJ, Cheng SH, Wentworth BM. Mol Ther Nucleic Acids. 2014 Oct 28;3:e206. doi: 10.1038/mtna.2014.57.
Injection & Electroporation or Peptide-linked Morpholino.

Splice-correcting oligonucleotides restore BTK function in X-linked agammaglobulinemia model. Bestas B, Moreno PM, Blomberg KE, Mohammad DK, Saleh AF, Sutlu T, Nordin JZ, Guterstam P, Gustafsson MO, Kharazi S, Piątosa B, Roberts TC, Behlke MA, Wood MJ, Gait MJ, Lundin KE, El Andaloussi S, Månsson R, Berglöf A, Wengel J, Smith CI. J Clin Invest. 2014 Aug 8. pii: 76175. doi: 10.1172/JCI76175. [Epub ahead of print].
Peptide-linked Morpholino.

Assessment of RT-qPCR Normalization Strategies for Accurate Quantification of Extracellular microRNAs in Murine Serum. Roberts TC, Coenen-Stass AML, Wood MJA. PLoS ONE. 2014;9(2):e89237. doi:10.1371/journal.pone.0089237.
Peptide-linked Morpholino.

Exon skipping restores dystrophin expression, but fails to prevent disease progression in later stage dystrophic dko mice. Wu C, Cloer C, Lu P, Milazi S, Shaban M, Shah SN, Marston-Poe L, Moulton HM, Lu QL. Gene Ther. 2014;[Epub ahead of print] doi:10.1038/gt.2014.53.
Peptide-linked Morpholino.

Unanchored K48-Linked Polyubiquitin Synthesized by the E3-Ubiquitin Ligase TRIM6 Stimulates the Interferon-IKKε Kinase-Mediated Antiviral Response. Rajsbaum R, Versteeg GA, Schmid S, Maestre AM, Belicha-Villanueva A, Martínez-Romero C, Patel JR, Morrison J, Pisanelli G, Miorin L, Laurent-Rolle M, Moulton HM, Stein DA, Fernandez-Sesma A, tenOever BR, García-Sastre A. Immunity. 2014;[Epub ahead of print] doi:10.1016/j.immuni.2014.04.018.
Peptide-linked Morpholino.

Induced IL-10 Splice Altering Approach to Antiviral Drug Discovery. Panchal RG, Mourich DV, Bradfute S, Hauck LL, Warfield KL, Iversen PL, Bavari S. Nucleic Acid Ther. 2014;24(3):179-185. doi:10.1089/nat.2013.0457.
Peptide-linked Morpholino.

Effective dystrophin restoration by a novel muscle-homing peptide-morpholino conjugate in dystrophin-deficient mdx mice. Gao X, Zhao J, Han G, Zhang Y, Dong X, Cao L, Wang Q, Moulton HM, Yin H. Mol Ther. 2014 Apr 15. doi: 10.1038/mt.2014.63. [Epub ahead of print].
Peptide-linked Morpholino.

Oocyte/Embryo Injection

Hira-Mediated H3.3 Incorporation Is Required for DNA Replication and Ribosomal RNA Transcription in the Mouse Zygote. Lin C-J, Koh FM, Wong P, Conti M, Ramalho-Santos M. Dev Cell. 2014;[Epub ahead of print] doi:10.1016/j.devcel.2014.06.022.
Oocyte microinjection.

WASH complex regulates Arp2/3 complex for actin-based polar body extrusion in mouse oocytes. Wang F, Zhang L, Zhang GL, Wang ZB, Cui XS, Kim NH, Sun SC. Sci Rep. 2014 Jul 7;4:5596. doi: 10.1038/srep05596.
Oocyte microinjection.

Possible Role of p38 MAPK-MNK1-EMI2 Cascade in Metaphase-II Arrest of Mouse Oocytes. Miyagaki Y, Kanemori Y, Tanaka F, Baba T. Biol Reprod. 2014;[Epub ahead of print] doi:10.1095/biolreprod.113.116962.
Oocyte microinjection.

Knockdown of RBBP7 unveils a requirement of histone deacetylation for CPC function in mouse oocytes. Balboula AZ, Stein P, Schultz RM, Schindler K. Cell Cycle. 2014;[epub ahead of print]13:0 - -1; PMID: 24317350.
Oocyte microinjection.

Comparison of Epigenetic Mediator Expression and Function in Mouse and Human Embryonic Blastomeres. Chavez SL, McElroy SL, Bossert NL, De Jonge CJ, Rodriguez MV, Leong DE, Behr B, Westphal LM, Pera RAR. Hum Mol Genet. 2014;[Epub ahead of print] doi:10.1093/hmg/ddu212.
Zygote microinjection.

Intracerebroventricular Injection of Bare Morpholino

Morpholino Antisense Oligonucleotides Targeting Intronic Repressor Element1 Improve Phenotype in SMA Mouse Models. Osman EY, Miller MR, Robbins KL, Lombardi AM, Atkinson AK, Brehm AJ, Lorson CL. Hum Mol Genet. 2014;[Epub ahead of print] doi:10.1093/hmg/ddu198.
SMNΔ7 ICV injection.

Electrophysiological Biomarkers in Spinal Muscular Atrophy: Proof of Concept. Arnold WD, Porensky PN, McGovern VL, Iyer CC, Duque S, Li X, Meyer K, Schmelzer L, Kaspar BK, Kolb SJ, Kissel JT, Burghes AH. Ann Clin Transl Neurol. 2014 Jan 1;1(1):34-44.
ICV injection.

Pharmacology of a central nervous system delivered 2'-o-methoxyethyl-modified survival of motor neuron splicing oligonucleotide in mice and nonhuman primates. Rigo F, Chun SJ, Norris DA, Hung G, Lee S, Matson J, Fey RA, Gaus H, Hua Y, Grundy JS, Krainer AR, Henry SP, Bennett CF. J Pharmacol Exp Ther. 2014 Jul;350(1):46-55. doi: 10.1124/jpet.113.212407. Epub 2014 Apr 30.
ICV injection.

RIG-I knockdown impedes neurogenesis in a murine model of Japanese encephalitis. Mukherjee S, Ghosh S, Nazmi A, Basu A. Cell Biol Int. 2014 Jul 31. doi: 10.1002/cbin.10354. [Epub ahead of print].
Intracerebral injection; murine neurospheres.

Other Delivery Strategies

HSPA5 is an essential host factor for Ebola virus infection. Patrick Reid S, Shurtleff AC, Costantino JA, Tritsch SR, Retterer C, Spurgers KB, Bavari S. Antiviral Res. 2014 Sep;109:171-4. doi: 10.1016/j.antiviral.2014.07.004. Epub 2014 Jul 11.
IP injection.

Serum-Free Culture of Mid-gestation Mouse Embryos: A Tool for the Study of Endoderm-Derived Organs. Gordon J, Moore BA, Blackburn CC, Manley NR. Methods Mol Biol 2014;[Epub ahead of print] doi: 10.1007/978-1-60327-292-6_12.
Electroporation into mouse embryo.

MiR-153 targets the nuclear factor-1 family and protects against teratogenic effects of ethanol exposure in fetal neural stem cells. Tsai P-C, Bake S, Balaraman S, Rawlings J, Holgate RR, Dubois D, Miranda RC. Biology Open. 2014;[Epub]doi:10.1242/bio.20147765.
Electroporation into single-cell suspensions from murine neurospheres.

Near-Infrared-Light-Based Nano-Platform Boosts Endosomal Escape and Controls Gene Knockdown in Vivo. Jayakumar MK, Bansal A, Huang K, Yao R, Li BN, Zhang Y. ACS Nano. 2014 Apr 14. [Epub ahead of print].
Nanoparticle.

Polymalic Acid-based Nano Biopolymers for Targeting of Multiple Tumor Markers: An Opportunity for Personalized Medicine? Ljubimova JY, Ding H, Portilla-Arias J, Patil R, Gangalum PR, Chesnokova A, Inoue S, Rekechenetskiy A, Nassoura T, Black KL, Holler E. J Vis Exp. 2014;(88):e50668. doi:10.3791/50668.
Nanoparticle.

Blockade of CD47 mediated CTSS-PAR2 signaling provides a therapeutic target for hepatocellular carcinoma. Lee TKW, Cheung VCH, Lu P, Lau EYT, Ma S, Tang KH, Tong M, Lo J, Ng IOL. Hepatology. 2014;[Epub ahead of print] doi:10.1002/hep.27070.
Intratumoral injection into human xenograft in mice.

Bubble Liposomes and Ultrasound Exposure Improve Localized Morpholino Oligomer Delivery into the Skeletal Muscles of Dystrophic mdx Mice. Negishi Y, Ishii Y, Shiono H, Akiyama S, Sekine S, Kojima T, Mayama S, Kikuchi T, Hamano N, Endo-Takahashi Y, Suzuki R, Maruyama K, Aramaki Y. Molec Pharmaceutics. 2014;[epub ahead of print] doi:10.1021/mp4004755.
Bubble liposomes & ultrasound delivery.

Evaluation of Tris[2-(acryloyloxy)ethyl]isocyanurate Cross-linked Polyethylenimine as Antisense Morpholino Oligomer Delivery Vehicle in Cell Culture and Dystrophic mdx Mice. Wang M. Hum Gene Ther. 2014 Jan 9. [Epub ahead of print].
Covalent PEI.

Splicing-Directed Therapy in a New Mouse Model of Human Accelerated Aging. Osorio FG, Navarro CL, Cadiñanos J, López-Mejía IC, Quirós PM, Bartoli C, Rivera J, Tazi J, Guzmán G, Varela I, Depetris D, de Carlos F, Cobo J, Andrés V, Sandre-Giovannoli AD, Freije JM, Lévy N, López-Otín C. Sci Transl Med. 2011 Oct 26;3(106):106ra107. doi: 10.1126/scitranslmed.3002847.

Phosphorodiamidate Morpholino Oligomers (PMOs) suppress mutant huntingtin expression and attenuate neurotoxicity. Sun X, Marque LO, Cordner Z, Pruitt JL, Bhat M, Li P, Kannan G, Ladenheim EE, Moran TH, Margolis RL, Rudnicki DD. Hum Mol Genet. 2014;[Epub ahead of print] doi:10.1093/hmg/ddu349.

Impaired functional communication between the L-type calcium channel and mitochondria contributes to metabolic inhibition in the mdx heart. Viola HM, Adams AM, Davies SM, Fletcher S, Filipovska A, Hool LC. Proc Natl Acad Sci U S A. 2014 Jun 26. pii: 201402544. [Epub ahead of print].

Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca2+‐CaMKII‐Regulated Induction of HDAC3arifi‐Sanjani M, Shoushtari AH, Quiroz M, Baust J, Sestito SF, Mosher M, Ross M, McTiernan CF, St. Croix CM, Bilonick RA, Champion HC, Isenberg JS. J Am Heart Assoc. 2014;3:e000670, originally published June 10, 2014, doi:10.1161/JAHA.113.000670.

Lomofungin and dilomofungin: inhibitors of MBNL1-CUG RNA binding with distinct cellular effects. Hoskins JW, Ofori LO, Chen CZ, Kumar A, Sobczak K, Nakamori M, Southall N, Patnaik S, Marugan JJ, Zheng W, Austin CP, Disney MD, Miller BL, Thornton CA. Nucleic Acids Res. 2014 May 5. [Epub ahead of print].
Electroporation into cultured mouse C2C12 myogenic cells.

Representative Recent Morpholino Citations for Hematology: 2014
Last edit: 4 Dec 2014

Characterization of an apparently synonymous F5 mutation causing aberrant splicing and factor V deficiency.
Nuzzo F, Bulato C, Nielsen BI, Lee K, Wielders SJ, Simioni P, Key NS, Castoldi E. Haemophilia. 2014 Dec 3. doi: 10.1111/hae.12554. [Epub ahead of print].

Loss of function mutations in RPL27 and RPS27 identified by whole-exome sequencing in Diamond-Blackfan anaemia. Wang R, Yoshida K, Toki T, Sawada T, Uechi T, Okuno Y, Sato-Otsubo A, Kudo K, Kamimaki I, Kanezaki R, Shiraishi Y, Chiba K, Tanaka H, Terui K, Sato T, Iribe Y, Ohga S, Kuramitsu M, Hamaguchi I, Ohara A, Hara J, Goi K, Matsubara K, Koike K, Ishiguro A, Okamoto Y, Watanabe K, Kanno H, Kojima S, Miyano S, Kenmochi N, Ogawa S, Ito E. Br J Haematol. 2014 Nov 25. doi: 10.1111/bjh.13229. [Epub ahead of print]

Live Imaging and Gene Expression Analysis in Zebrafish Identifies a Link between Neutrophils and Epithelial to Mesenchymal Transition. Freisinger CM, Huttenlocher A. PLoS One. 2014 Nov 5;9(11):e112183. doi: 10.1371/journal.pone.0112183. eCollection 2014.

Nkx2.5 is involved in myeloid cell differentiation at anterior ventral blood islands in the Xenopus embryo. Sakata H, Maéno M. Dev Growth Differ. 2014 Oct 3. doi: 10.1111/dgd.12155. [Epub ahead of print]

Proinflammatory Signaling Regulates Hematopoietic Stem Cell Emergence. Espín-Palazón R, Stachura DL, Campbell CA, García-Moreno D, Del Cid N, Kim AD, Candel S, Meseguer J, Mulero V, Traver D. Cell. 2014;[Epub ahead of print] doi:10.1016/j.cell.2014.10.031

Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Li Y, Esain V, Teng L, Xu J, Kwan W, Frost IM, Yzaguirre AD, Cai X, Cortes M, Maijenburg MW, Tober J, Dzierzak E, Orkin SH, Tan K, North TE, Speck NA. Genes Dev. 2014;[Epub ahead of print] doi:10.1101/gad.253302.114

Identification of Cdca7 as a novel Notch transcriptional target involved in hematopoietic stem cell emergence. Guiu J, Bergen DJM, De Pater E, Islam ABMMK, Ayllón V, Gama-Norton L, Ruiz-Herguido C, González J, López-Bigas N, Menendez P, Dzierzak E, Espinosa L, Bigas A. J Exp Med. 2014;[Epub ahead of print] doi:10.1084/jem.20131857

ETV6 (TEL1) regulates embryonic hematopoiesis in zebrafish. Rasighaemi P, Onnebo SM, Liongue C, Ward AC. Haematologica. 2014 Oct 3. pii: haematol.2014.104091. [Epub ahead of print].

Discrete Notch signaling requirements in the specification of hematopoietic stem cells. Kim AD, Melick CH, Clements WK, Stachura DL, Distel M, Panáková D, MacRae C, Mork LA, Crump JG, Traver D. EMBO J. 2014 Oct 16;33(20):2363-73. doi: 10.15252/embj.201488784. Epub 2014 Sep 17.

Systematic transcriptome analysis of the zebrafish model of diamond-blackfan anemia induced by RPS24 deficiency. Song B, Zhang Q, Zhang Z, Wan Y, Jia Q, Wang X, Zhu X, Leung A Y-H, Cheng T, Fang X, Yuan W, Jia H. BMC Genomics. 2014;15:759. doi:10.1186/1471-2164-15-759.

miR-142-3p acts as an essential modulator of neutrophil development in zebrafish. Fan HB, Liu YJ, Wang L, Du TT, Dong M, Gao L, Meng ZZ, Jin Y, Chen Y, Deng M, Yang HT, Jing Q, Gu AH, Liu TX, Zhou Y. Blood. 2014 Aug 21;124(8):1320-30. doi: 10.1182/blood-2013-12-545012. Epub 2014 Jul 2.

The DPY30 subunit in SET1/MLL complexes regulates the proliferation and differentiation of hematopoietic progenitor cells. Yang Z, Augustin J, Chang C, Hu J, Shah K, Chang C-W, Townes T, Jiang H. Blood. 2014 Sep 25;124(13):2025-33. doi: 10.1182/blood-2014-01-549220. Epub 2014 Aug 18.

Drl.3 governs primitive hematopoiesis in zebrafish. Pimtong W, Datta M, Ulrich AM, Rhodes J. Sci Rep. 2014 Sep 4;15(3):376-91. doi: 10.1016/j.stem.2014.06.005. Epub 2014 Jul 17.

A Systems Biology Approach for Defining the Molecular Framework of the Hematopoietic Stem Cell Niche. Charbord P, Pouget C, Binder H, Dumont F, Stik G, Levy P, Allain F, Marchal1 C, Richter J, Uzan B, Pflumio F, Letourneur F, Wirth H, Dzierzak E, Traver D, Jaffredo T, Charles Durand C. Cell Stem Cell. 2014;[Epub ahead of print] doi:10.1016/j.stem.2014.06.005.

A Loss of Function Screen of Identified Genome-Wide Association Study Loci Reveals New Genes Controlling Hematopoiesis. Bielczyk-Maczyńska E, Serbanovic-Canic J, Ferreira L, Soranzo N, Stemple DL, Ouwehand WH, Cvejic A. PLoS Genet. 2014;10(7):e1004450. doi:10.1371/journal.pgen.1004450.

Ncor2 is required for hematopoietic stem cell emergence by inhibiting Fos signaling in zebrafish. Wei Y, Ma D, Gao Y, Zhang C, Wang L, Liu F. Blood. 2014 Sep 4;124(10):1578-85. doi: 10.1182/blood-2013-11-541391. Epub 2014 Jul 8.

Gcsf-Chr19 Promotes Neutrophil Migration to Damaged Tissue through Blood Vessels in Zebrafish. Galdames JA, Zuñiga-Traslaviña C, Reyes AE, Feijóo CG. J Immunol. 2014 Jul 1;193(1):372-8. doi: 10.4049/jimmunol.1303220. Epub 2014 Jun 2.

The role of the DNA damage response in zebrafish and cellular models of Diamond Blackfan anemia. Danilova N, Bibikova E, Covey TM, Nathanson D, Dimitrova E, Konto Y, Lindgren A, Glader B, Radu CG, Sakamoto KM, Lin S. Dis Model Mech. 2014 Jul;7(7):895-905. doi: 10.1242/dmm.015495. Epub 2014 May 8.

Estrogen defines the dorsal-ventral limit of VEGF regulation to specify the location of the hemogenic endothelial niche. Carroll KJ, Esain V, Garnaas MK, Cortes M, Dovey MC, Nissim S, Frechette GM, Liu SY, Kwan W, Cutting CC, Harris JM, Gorelick DA, Halpern ME, Lawson ND, Goessling W, North TE. Dev Cell. 2014 May 27;29(4):437-53. doi: 10.1016/j.devcel.2014.04.012.

Lysophosphatidic acid acts as a nutrient-derived developmental cue to regulate early hematopoiesis. Li H, Yue R, Wei B, Gao G, Du J, Pei G. 2014 Jun 17;33(12):1383-96. doi: 10.15252/embj.201387594. Epub 2014 May 14.

Homeobox transcription factor VentX regulates differentiation and maturation of human dendritic cells. Wu X, Gao H, Bleday R, Zhu Z. J Biol Chem. 2014 May 23;289(21):14633-43. doi: 10.1074/jbc.M113.509158. Epub 2014 Apr 4.

Protein tyrosine phosphatase PTPN9 regulates erythroid cell development through STAT3 dephosphorylation in zebrafish. Bu Y, Su F, Wang X, Gao H, Lei L, Chang N, Wu Q, Hu K, Zhu X, Chang Z, Meng K, Xiong J-W. J Cell Sci. 2014 Jun 15;127(Pt 12):2761-70. doi: 10.1242/jcs.145367. Epub 2014 Apr 11.

Functions of FMS-like tyrosine kinase 3 (flt3) in zebrafish hematopoiesis and its relevance to human acute myeloid leukemia. He B-L, Shi X, Man CH, Ma ACH, Ekker SC, Chow HCH, So CWE, Choi WWL, Zhang W, Zhang Y, Leung AYH. Blood. 2014 Apr 17;123(16):2518-29. doi: 10.1182/blood-2013-02-486688. Epub 2014 Mar 3.

Zebrafish eaf1 Suppresses foxo3b Expression to Modulate Transcriptional Activity of gata1 and spi1 in Primitive Hematopoiesis. Hu B, Zhang W, Feng X, Ji W, Xie X, Xiao W. Dev Biol. 2014 Apr 1;388(1):81-93. doi: 10.1016/j.ydbio.2014.01.005. Epub 2014 Jan 17.

Elavl1a regulates zebrafish erythropoiesis via post-transcriptional control of gata1. Li X, Lu YC, Dai K, Torregroza I, Hla T, Evans T. Blood. 2014 Feb 27;123(9):1384-92. doi: 10.1182/blood-2013-09-526962. Epub 2014 Jan 14.

TET2 plays an essential role in erythropoiesis by regulating lineage-specific genes via DNA oxidative demethylation in a zebrafish model. Ge L, Zhang RP, Wan F, Guo DY, Wang P, Xiang LX, Shao JZ. Mol Cell Biol. 2014 Mar;34(6):989-1002. doi: 10.1128/MCB.01061-13. Epub 2014 Jan 6.

Therapeutic antagonists of microRNAs deplete leukemia-initiating cell activity. Velu CS, Chaubey A, Phelan JD, Horman SR, Wunderlich M, Guzman ML, Jegga AG, Zeleznik-Le NJ, Chen J, Mulloy JC, Cancelas JA, Jordan CT, Aronow BJ, Marcucci G, Bhat B, Gebelein B, Grimes HL. J Clin Invest. 2014 Jan 2;124(1):222-36. doi: 10.1172/JCI66005. Epub 2013 Dec 16.