Jon-D's blog

Here is a discussion of protein interactions and other cellular changes caused by phosphorothioate oligos that are not seen with Morpholinos.

Flynn LL, Li R, Aung-Htut MT, Pitout IL, Cooper J, Hubbard A, Griffiths L, Bond C, Wilton SD, Fox AH, Fletcher S. Interaction of modified oligonucleotides with nuclear proteins, formation of novel nuclear structures and sequence-independent effects on RNA processing. bioRxiv. 2018:446773[Preprint] doi:10.1101/446773

https://www.biorxiv.org/content/early/2018/10/18/446773

I try to send this message with any designs involving five-mispair oligos. A brief version is farther down.

--------------------------------------------------------------------------------------

** Argument for using a different specificity control instead of the five-mispair

I don't like the five mispair experiment. In the "Guidelines for morpholino use in zebrafish" (useful regardless of your model system), Stainier et al. write: "5-base mismatch MO ... cannot serve as controls for the specificity of the experimental MO."[1] It is not surprising if a five mispair oligo causes some phenotype. Many five mispair oligos do not cause phenotypes when used at the same concentration for which the targeted oligo is just high enough concentration to cause a phenotype. However, we do occasionally hear reports of phenotypes associated with five mispair oligos, which makes interpreting the five mispair experiment very difficult.

It is common practice to use two non-overlapping oligos targeting the same RNA as a specificity control set. If the oligos (used in separate experiments) phenocopy one another, that indicates that the phenotype is most likely due to interaction with the target RNA and not an unexpected interaction with a different RNA. For an oligo-based specificity control, I prefer the two-nonoverlapping-oligo technique instead of the five mispair technique. The two non-overlapping oligo experiment directly addresses the question "is the phenotype I am observing due to knockdown of my targeted gene or due to an off-target RNA interaction?" The five mispair experiment, in contrast, addresses the question "if a Morpholino has five mispairs distributed though its sequence, will it still elicit the same phenotype as my targeted oligo when the same dose is administered?" I think the first question is far more important than the second. The second non-overlapping oligo can also be co-injected with the first targeted oligo to test dose synergy in eliciting phenotype, which if observed both:
- provides further support for specificity of the knockdown, and
- may be useful as a tactic to cause a more complete knockdown. [2]

When an mRNA rescue works, it is also a very good specificity control. Unfortunately, developmental changes due to ectopic expression from a rescue mRNA sometimes occludes successful rescue from a knockdown phenotype.

My favorite specificity control is where a Morpholino is tested in a mutant that is a null for the Morpholino target, then subsequently tested in a wild-type organism. For some thoughts on using an engineered mutant as a Morpholino specificity control, see Stainier et al.'s discussion [1].

[1] Stainier DYR, Raz E, Lawson ND, Ekker SC, Burdine RD, Eisen JS, Ingham PW, Schulte-Merker S, Yelon D, Weinstein BM, Mullins MC, Wilson SW, Ramakrishnan L, Amacher SL, Neuhauss SCF, Meng A, Mochizuki N, Panula P, Moens CB. Guidelines for morpholino use in zebrafish. PLoS Genet. 2017 Oct 19;13(10):e1007000. doi: 10.1371/journal.pgen.1007000.
http://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.10...

[2] Bill BR, Petzold AM, Clark KJ, Schimmenti LA, Ekker SC. A primer for morpholino use in zebrafish. Zebrafish. 2009 Mar;6(1):69-77.
http://www.liebertonline.com/doi/pdfplus/10.1089/zeb.2008.0555

--------------------------------------------------------------------------------------

Let me rephrase the discussion regarding mismatched controls, presenting my opinion more directly. Mismatched "controls" are scientifically worthless, prone to have unexpected RNA interactions that make interpretation difficult, devoid of useful information about specificity even when there is no associated phenotype, and reviewers are finally realizing that. The zebrafish community paper I cited above says that mispair oligos are unacceptable as specificity controls. I strongly suggest you select a different control strategy. That paper (Stainier et al. 2017) is a very good place to start for evaluating controls for steric-blocking oligos (like Morpholinos).

HPLC purifications are most effective when Morpholinos are conjugated to a relatively big molecule, such as a peptide (say ca. 200 Daltons or larger), or are conjugated with a net-charged moiety and then the conjugate is purified to remove unreacted oligo. If you are adding a relatively small reactive group and subsequently adding the large molecule, it is probably best to do both additions prior to the purification; that way it is easier to separate the unreacted Morpholino and the activated Morpholino from the conjugate of the Morpholino with the large molecule. You will need to select a column and a mobile phase that exploit a physical property difference between the unreacted Morpholino and its conjugate, whether different hydrophobicity, charge, size, etc. [1].

If you add a cationic peptide, you might want to put the peptide onto the Morpholino and then run the conjugation product over a cation exchange resin. That captures the conjugated oligos and unconjugated peptide and lets other components, including unconjugated oligos, pass through the column. Then you need to come up with some gentle elution conditions that work for your peptide-Morpholino conjugate [2].

For oligo analysis, you can use reverse-phase HPLC to separate Morpholino species but the resolution is usually not good. By running the oligos in a pH and salt gradient, starting with high pH to deprotonate the G and T bases, you can use an anion-exchange column (e.g. quaternary alkylammonium packing). As the pH drops the oligos protonate and elute. We used to use this for quality-control analysis of Morpholinos before switching to MALDI-TOF. This method isn’t likely to be useful for preparative HPLC, as the pH conditions are harsh at the start and might damage the oligos.

Morpholinos can be dissolved in water, water-alcohol, or water-acetonitrile solutions. Water with up to 50% acetonitrile can be removed from the oligos by lyophilization. Solubility of a Morpholino varies with the sequence of the oligo.

Possible contaminants include oligos missing one or more bases either internally or at the end (n-1 to n-x sequences for an n-base oligo), sequences capped at the 3’-end (perhaps by a base protection group migrating to the terminal morpholine nitrogen), and oligos with one or more bases still bearing a protecting group. Fortunately, such contaminants are small fractions compared to the desired oligo and will have little or no biological activity at the low concentrations present when the oligos are used, demonstrated by the widespread use of Morpholinos for embryo injection without HPLC purification. Some components such as oligos with a 3’-capping group, will be removed when separating unreacted oligo from oligo conjugates by HPLC (capped oligos would not be expected to migrate with the oligo conjugates).

Morpholinos can be detected in biological matrices by hybridization with a base-complementary fluorescent probe followed by HPLC using a fluorescence detector [3,4]. Other options for detection of Morpholinos in biological samples include a similar fluorescence hybridization approach using capillary electrophoresis [5], employing surface plasmon resonance with a base-complementary nucleic acid capture surface [6], using flow cytometry-FISH or sandwich hybridization assays [7] or ELISA [8,9].

[1] For size-exclusion HPLC, see:
Liu G, Mang'era K, Liu N, Gupta S, Rusckowski M, Hnatowich DJ. Tumor Pretargeting in Mice Using (99m)Tc-Labeled Morpholino, a DNA Analog. J Nucl Med. 2002 Mar;43(3):384-391.

[2] For cation-exchange column HPLC, see:
Shabanpoor F, Gait MJ. Development of a general methodology for labelling peptide-morpholino oligonucleotide conjugates using alkyne-azide click chemistry. Chem Commun (Camb). 2013 Nov 11;49(87):10260-2. doi: 10.1039/c3cc46067c.

[3] For HPLC analysis of Morpholinos from a biological matrix, see:
Arora V, Knapp DC, Reddy MT, Weller DD, Iversen PL.. Bioavailability and efficacy of antisense morpholino oligomers targeted to c-myc and cytochrome P-450 3A2 following oral administration in rats. J Pharm Sci. 2002 Apr;91(4):1009-18.

[4] For HPLC analysis from a biological matrix also see this poster submitted to the AAPS NBC 2016 conference:
Sun R, Tim S, Clegg R, Bravo O, Zhang J, Rutkowski J. HPLC/FL Quantitation Methods of Eteplirsen in Biological Matrices.
http://abstracts.aaps.org/Verify/NBC16/PosterSubmissions/M1079.pdf

[5] For capillary gel electrophoresis detection of Morpholinos from a biological matrix, see:
Heald AE, Charleston JS, Iversen PL, Warren TK, Saoud JB, Al-Ibrahim M, Wells JW, Warfield KL, Swenson DL, Welch LS, Sazani P, Wong M, Berry D, Kaye EM, Bavari S. AVI-7288 for Marburg Virus in Nonhuman Primates and Humans. New Engl J Med. 2015;373:339-48. doi:10.1056/NEJMoa1410345.

[6] For surface plasmon resonance detection of Morpholinos from a biological matrix, see:
Boutilier J, Moulton HM. Surface Plasmon Resonance-Based Concentration Determination Assay: Label-Free and Antibody-Free Quantification of Morpholinos. Methods Mol Biol. 2017;1565:251-263. doi: 10.1007/978-1-4939-6817-6_21.

[7] For flow cytometry-FISH or sandwich hybridization detection of Morpholinos from a biological matrix, see:
Schnell FJ, Crumley SL, Mourich DV, Iversen PL. Development of Novel Bioanalytical Methods to Determine the Effective Concentrations of Phosphorodiamidate Morpholino Oligomers in Tissues and Cells. Biores Open Access. 2013 Feb;2(1):61-6. doi: 10.1089/biores.2012.0276.

[8] For ELISA-based detection of Morpholinos from a biological matrix, see:
Burki U, Straub V. Ultrasensitive Hybridization-Based ELISA Method for the Determination of Phosphorodiamidate Morpholino Oligonucleotides in Biological samples. Methods Mol Biol. 2017;1565:265-277. doi: 10.1007/978-1-4939-6817-6_22.

[9] Burki U, Keane J, Blain A, O'Donovan L, Gait MJ, Laval SH, Straub V. Development and Application of an Ultrasensitive Hybridization-Based ELISA Method for the Determination of Peptide-Conjugated Phosphorodiamidate Morpholino Oligonucleotides. Nucleic Acid Ther. 2015 Jul 15. [Epub ahead of print].

Exon Skipping and Inclusion Therapies
Editors: Toshifumi Yokota. Rika Maruyama
2018 Humana Press, New York, NY
doi:10.1007/978-1-4939-8651-4
ISBN 978-1-4939-8650-7
https://link.springer.com/book/10.1007/978-1-4939-8651-4#toc

Gene Tools offers several negative controls that are offered at reduced prices or we can synthesize custom oligos to use as negative controls. I suggest, at least initially, using the standard control oligo.

The most widely reported Morpholino negative control is our standard control oligo. It does affect gene expression, but far less than most targeted oligos. It is a stock item that we offer in 100 nanomole quantity (optionally with a fluorescent label). The standard control oligo is a single sequence, CCTCTTACCTCAGTTACAATTTATA, that targets a human beta-globin intron mutation that causes beta-thalassemia. This oligo causes little change in phenotype in any known test system except human beta-thalassemic hematopoetic cells; it has been broadly used as a negative control. Every single-sequence control oligo has some risk of triggering off-target knockdowns, but the standard control sequence has been extensively used with few reports of off-target effects at reasonable doses. The fluoresceinated standard control is also a useful tool for confirming oligo delivery into the cytosol by fluorescence microscopy.

An alternative to the standard control oligo that is also available as an off-the-shelf item is our random control 25-N, a 25-base mixture of oligos which is synthesized with a random base mixture at every position. We offer the mixture in 100 nanomole quantity (that is, 100 nanomoles of Morpholino backbone with a mixture of base sequences). We write the sequence as NNNNNNNNNNNNNNNNNNNNNNNNN. This is an oligo constructed by delivering a mixture of all four activated Morpholino subunits at each step of oligo elongation, producing a mixture of sequences that, in theory, contains every possible 25-base sequence. Our reported molecular mass of 8463 Da is the predicted mean mass of the mixture; a MALDI-TOF spectrum shows a distribution of masses. Once resuspended and used as if it were a pure oligo preparation, this mixture controls for the presence of the Morpholino backbone but the concentration of any given sequence in the mixture is vanishingly low, well below the threshold for triggering an observable sequence-specific biological outcome; however, the combination of sequences has been shown to slightly perturb gene expression (Gene Tools and Phalanx Biotech Group, unpublished collaboration). Because the 25-N mixture does not give a clear single mass peak by MALDI-TOF, we cannot control for quality of end modification and so we do not offer this mixture with fluorescent tags or other optional groups. The random control 25-N is intended for use as a negative control.

In a microarray study comparing gene modulation of the standard control oligo with the 25-N random control oligo mixture, the standard control showed more RNA modulation in a zebrafish embryo than did the random control (Gene Tools and Phalanx Biotech Group, unpublished collaboration).

Another possible negative control is the invert oligo, a custom oligo matched with a targeting oligo but for which the sequence is reversed 5'-3' to 3'-5'. This oligo will have the same base composition as the targeting oligo but will not bind to the targeting oligo's complementary RNA target. However, the invert oligo could have other targets in the transcriptome so a doing a careful BLAST analysis is prudent. Because an invert oligo is a custom sequence prepared for use with a particular targeting oligo, the invert oligo is a full-price custom synthesis.

I use my blog to keep track of Morpholino information that might be useful to me; that can make it tough to find the more broadly useful posts. Here's a linked list of posts I think might be useful to others.

http://www.gene-tools.com/content/selected-posts-jons-blog

Wu X, Shen W, Zhang B, Meng A. The genetic program of oocytes can be modified in vivo in the zebrafish ovary. J Mol Cell Biol. 2018 Jul 28. doi: 10.1093/jmcb/mjy044. [Epub ahead of print]

https://academic.oup.com/jmcb/article-lookup/doi/10.1093/jmcb/mjy044

"Furthermore, maternal knockdown of dnmt1 by antisense morpholino via OMIS results in a dramatic decrease of global DNA methylation level at the dome stage and causes embryonic lethality prior to segmentation period."

Morpholinos have been used to alter activity of non-coding RNAs. A citation list is here:
"Other" targets: ncRNA, repeated elements, etc.

Targeting non-coding RNAs presents special problems. Ideally, we need to know where on the non-coding RNA an activity is located that we can block. You will need to tell us where you want the oligo targeted and we’ll try to find the best oligo sequence targeting that location.

For targeting miRNAs, we target to alter the stem-loop structure of the pri-miRNA so that it will not be cleaved by the double-strand nucleases needed for maturing the miRNA (e.g. Drosha, Dicer). Our Design Request Website has a selection available for designing Morpholinos targeting miRNA (https://oligodesign.gene-tools.com/request/).

If the non-coding RNA undergoes splicing, then we can potentially modify the splicing with a Morpholino to excise an exon or insert an intron. In some cases this has been used productively to alter the activity of a non-coding RNA. Targeting a Morpholino to splicing of a non-coding RNA follows the same rules as for targeting a pre-mRNA; typically we target mostly-intronic sequence at a splice junction. Our Design Request Website has a selection available for designing Morpholinos targeting splicing.

We can also directly target activities of non-coding RNAs involving complementary sequence interactions, secondary structure or “sponge” activity. For instance, perhaps the non-coding RNA has a sequence motif that is complementary to another RNA and there is an activity caused by the interaction of the non-coding RNA and the other RNA by complementary base pairing; in that case, we can target a Morpholino oligo across that complementary motif the block the interaction of the two RNAs. Perhaps instead the non-coding RNA's activity is due to a region of secondary structure, such as a crucial stem-loop; in that case, we can target a Morpholino to the stem in order to invade the stem structure, displacing one strand of the stem from the other strand and altering the secondary structure and hopefully altering the activity of that region of the non-coding RNA. Perhaps the non-coding RNA is binding a particular protein or miRNA, acting as a "sponge"; covering the binding site of the protein or miRNA with a Morpholino might productively block the interaction of the RNA with its binding partner. Our Design Request Website has a selection available for designing Morpholinos “Other”; this is an appropriate place to submit sequence for non-coding RNA targets.

To block any of these activities with a Morpholino oligo, we need to know where the activity is located on the non-coding RNA. Recall that Morpholinos do not degrade their RNA targets, so randomly targeting a Morpholino to a non-coding RNA is unlikely to alter the activity of the non-coding RNA. The chances are good that a random target will be distant from the site of the non-coding RNA's activity. So, to design a useful Morpholino for a non-coding RNA we need to know where that activity is located in the non-coding RNA sequence (the base-pairing region, the stem-loop, the binding site, etc.). Please send some sequence for the non-coding RNA with the RNA sequence in UPPER CASE and the active region in lower case, like this:

ATCGTCTATTGTTTCAACTTTTTcgtgctttgatacgcgcgtgatGCTAATACGATTTACTACCATATGAG

We'll look for a good oligo sequence complementary to most or all of the lower case region.

Watching dynamics of RNA expression - paper describing a visualization technique.

Movie 1: https://www.biorxiv.org/highwire/filestream/112058/field_highwire_adjunct_files/3/366468-4.mp4

Movie 1 from supplemental information: in this zebrafish embryo, DNA is stained with red fluorescence. Carboxyfluoresceinaed Morpholino oligos targeting dre-miR-430 emit visible green fluorescence when they reach sufficient localized concentration. In red you can watch condensation of chromosomes, mitosis, and loosening of the chromatin. After a few divisions you will see green dots appear where groups of miR430 genes are being transcribed and capturing fluorescent-labeled Morpholinos. Each nucleus contains two dots, the maternal and paternal chromosomes revealing the site of miR430 transcription. The green dots disappear as the red chromosomes condense out of the chromatin for mitosis and gene expression halts for division. This movie shows the early-to-mid blastula stages and the onset of zygotic transcription occurs at mid-blastula, so you don't see the green dots appear during the first few cell divisions; early on the cells are expressing maternal mRNAs that are already present in the egg. The onset of zygotic transcription is where the embryo begins to rely on its own genome.

The paper: https://www.biorxiv.org/content/early/2018/07/15/366468

Hadzhiev Y, Qureshi H, Wheatley L, Cooper L, Jasiulewicz A, Nguyen HV, Wragg J, Poovathumkadavil D, Conic S, Bajan S, Sik A, Hutvagner G, Tora L, Gambus A, Fossey JS, Mueller F. A cell cycle-coordinated nuclear compartment for Polymerase II transcription encompasses the earliest gene expression before global genome activation. BioRXive. 2018;[Epub] doi:doi.org/10.1101/366468.

A researcher asked about the half-life of the Morpholino. This is much of my response.

The half-life of the molecule is not very useful for experiment planning. The oligos do not degrade (Hudziak RM et al. 1996, Youngblood DS et al. 2007), but their activity is temporarily lost when they bind to complementary RNA; that binding rate is what sets the trajectory of biological activity. Eventually the RNA will degrade off the oligo and release it, but the RNA footprint can be protected from nuclease activity by the Morpholino so this is a slow process, leading to a persistent background of activity well below experimental utility (but reported as weak splice-modifying activity over three months after a single dose in mice, Wells 2008). We typically see about four days of useful knockdown in cultured cells or systemically with a Vivo-Morpholino. Larger doses of Morpholino will persist longer, but the resulting higher oligo concentration in cells might lead to some off-target RNA interaction (and the dose of a Vivo-Morpholino will be limited by toxicity). The rate of new transcription of a particular RNA is an important factor for the duration of a Morpholino knockdown; slow transcription helps the oligo activity persist longer, while rapid transcription can swamp the oligo quickly, leading to a short knockdown. The turnover rate of the protein affects how soon you can detect the knockdown; the oligo might halt transcription, but the protein concentration decreases as a function of its degradation and in some cases can be fairly slow.

Hudziak RM, Barofsky E, Barofsky DF, Weller DL, Huang SB, Weller DD. Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation. Antisense Nucleic Acid Drug Dev 1996 Winter;6(4):267-72.

Youngblood DS, Hatlevig SA, Hassinger JN, Iversen PL, Moulton HM. Stability of cell-penetrating Peptide-morpholino oligomer conjugates in human serum and in cells. Bioconjug Chem. 2007 Jan-Feb;18(1):50-60.
(note the persistence of the signals corresponding to the mass of the bare oligo without peptide)

Wells DJ. Gene doping: the hype and the reality. Br J Pharmacol. 2008 Jun;154(3):623-31. Epub 2008 Apr 21.