Gene Tools offers several negative controls that are offered at reduced prices or we can synthesize custom oligos to use as negative controls. I suggest, at least initially, using the standard control oligo.
The most widely reported Morpholino negative control is our standard control oligo. It does affect gene expression, but far less than most targeted oligos. It is a stock item that we offer in 100 nanomole quantity (optionally with a fluorescent label). The standard control oligo is a single sequence, CCTCTTACCTCAGTTACAATTTATA, that targets a human beta-globin intron mutation that causes beta-thalassemia. This oligo causes little change in phenotype in any known test system except human beta-thalassemic hematopoetic cells; it has been broadly used as a negative control. Every single-sequence control oligo has some risk of triggering off-target knockdowns, but the standard control sequence has been extensively used with few reports of off-target effects at reasonable doses. The fluoresceinated standard control is also a useful tool for confirming oligo delivery into the cytosol by fluorescence microscopy.
An alternative to the standard control oligo that is also available as an off-the-shelf item is our random control 25-N, a 25-base mixture of oligos which is synthesized with a random base mixture at every position. We offer the mixture in 100 nanomole quantity (that is, 100 nanomoles of Morpholino backbone with a mixture of base sequences). We write the sequence as NNNNNNNNNNNNNNNNNNNNNNNNN. This is an oligo constructed by delivering a mixture of all four activated Morpholino subunits at each step of oligo elongation, producing a mixture of sequences that, in theory, contains every possible 25-base sequence. Our reported molecular mass of 8463 Da is the predicted mean mass of the mixture; a MALDI-TOF spectrum shows a distribution of masses. Once resuspended and used as if it were a pure oligo preparation, this mixture controls for the presence of the Morpholino backbone but the concentration of any given sequence in the mixture is vanishingly low, well below the threshold for triggering an observable sequence-specific biological outcome; however, the combination of sequences has been shown to slightly perturb gene expression (Gene Tools and Phalanx Biotech Group, unpublished collaboration). Because the 25-N mixture does not give a clear single mass peak by MALDI-TOF, we cannot control for quality of end modification and so we do not offer this mixture with fluorescent tags or other optional groups. The random control 25-N is intended for use as a negative control.
In a microarray study comparing gene modulation of the standard control oligo with the 25-N random control oligo mixture, the standard control showed more RNA modulation in a zebrafish embryo than did the random control (Gene Tools and Phalanx Biotech Group, unpublished collaboration).
Another possible negative control is the invert oligo, a custom oligo matched with a targeting oligo but for which the sequence is reversed 5'-3' to 3'-5'. This oligo will have the same base composition as the targeting oligo but will not bind to the targeting oligo's complementary RNA target. However, the invert oligo could have other targets in the transcriptome so a doing a careful BLAST analysis is prudent. Because an invert oligo is a custom sequence prepared for use with a particular targeting oligo, the invert oligo is a full-price custom synthesis.
Add new comment